Home Group Register Sign in Contact Us Sitemap
Learn more
Name Sequence(5'-3') Name Sequence(5'-3')
1492R TACGGYTACCTTGTTACGACTT M13R-pUC CAGGAAACAGCTATGAC
27F AGAGTTTGATCMTGGCTCAG MT_Forward CATCTCAGTGCAACTAAA
35S-A AAGGGTCTTGCGAAGGATAG pBacPAC-RP GTCTGTAAATCAACAACGC
35S-B AGTGGAAAAGGAAGGTGGCT pBAD-F ATGCCATAGCATTTTTATCCA
518F CCAGCAGCCGCGGTAATACG pBAD-FP ATGCCATAGCATTTTTATCC
800R TACCAGGGTATCTAATCC pBAD-R GATTTAATCTGTATCAGG
AD_Reverse AGATGGTGCACGATGCACAG pDONOR-FP TAACGCTAGCATGGATCTC
a-Factor TACTATTGCCAGCATTGCTGC pEGFP_N CCGTCCAGCTCGACCAG
AOX1_Forward GACTGGTTCCAATTGACAAGC pEGFP-FP TTTAGTGAACCGTCAGATC
AOX1_Reverse GCAAATGGCATTCTGACATCC pEGFP-RP AACAGCTCCTCGCCCTTG
BGH-R TAGAAGGCACAGTCGAGG pESP-RP TCCAAAAGAAGTCGAGTGG
Bluescript_KS TCGAGGTCGACGGTATC pET-24a GGGTTATGCTAGTTATTGCTCAG
Bluescript_SK CGCTCTAGAACTAGTGGATC pET-RP CTAGTTATTGCTCAGCGG
CMV-F CGCAAATGGGCGGTAGGCGTG pFastBac_Forward GGATTATTCATACCGTCCCA
CYC1_Reverse GCGTGAATGTAAGCGTGAC pFastBac_Reverse CAAATGTGGTATGGCTGATT
DsRed1-C AGCTGGACATCACCTCCCACAACG pGEX3 GGAGCTGCATGTGTCAGAGG
DsRed1-N GTACTGGAACTGGGGGGACAG pGEX5 GGCAAGCCACGTTTGGTG
EBV-RP GTGGTTTGTCCAAACTCATC pJET1_2F CGACTCACTATAGGGAGAGCGGC
EGFP-C CATGGTCCTGCTGGAGTTCGTG pJET1_2R AAGAACATCGATTTTCCATGGCAG
EGFP-CF AGCACCCAGTCCGCCCTGAGC pMalE TCAGACTGTCGATGAAGC
EGFP-CR CGTCCATGCCGAGAGTG pQE-F CCCGAAAAGTGCCACCTG
EGFP-N CGTCGCCGTCCAGCTCGACCAG pQE-R GTTCTGAGGTCATTACTGG
EGFP-NR CGTCGCCGTCCAGCTC pREP-fwd_primer GCTCGATACAATAAACGCC
GAL1_Forward AATATACCTCTATACTTTAACGTC pRH_Forward CTGTCTCTATACTCCCCTATAG
Gal4AD TACCACTACAATGGATG pRH_Reverse CAAAATTCAATAGTTACTATCGC
GLprimer1 TGTATCTTATGGTACTGTAACTG pTrcHis_Forward GAGGTATATATTAATGTATCG
GLprimer2 CTTTATGTTTTTGGCGTCTTCCA QE_Promoter CCGAAAAGTGCCACCTG
HCO2198 TAAACTTCAGGGTGACCAAAAAATCA RVprimer3 CTAGCAAAATAGGCTGTCCC
ITS1 TCCGTAGGTGAACCTGCGG RVprimer4 GACGATAGTCATGCCCCGCG
ITS2 GCTGCGTTCTTCATCGATGC SP6 ATTTAGGTGACACTATAG
ITS3 GCATCGATGAAGAACGCAGC STag_18mer_Primer GAACGCCAGCACATGGAC
ITS4 TCCTCCGCTTATTGATATGC SV40-pArev CCTCTACAAATGTGGTATGG
ITS5 GGAAGTAAAAGTCGTAACAAGG SV40-Promoter GCCCCTAACTCCGCCCATCC
KAN2-FP ACCTACAACAAAGCTCTCATCAACC T3 AATTAACCCTCACTAAAGGG
KAN2-RP GCAATGTAACATCAGAGATTTTGAG T7 AATACGACTCACTATAG
LCO1490 GGTCAACAAATCATAAAGATATTGG T7_EEV ATGTCGTAATAACCCCGCCCCG
M13F GTAAAACGACGGCCAGT T7promoter TAATACGACTCACTATAGGG
M13-FP TGTAAAACGACGGCCAGT T7terminator GCTAGTTATTGCTCAGCGG
M13F-pUC GTTTTCCCAGTCACGAC U-19mer_Primer GTTTTCCCAGTCACGACGT
M13R GCGGATAACAATTTCACACAGG